Monte
sua
prova

Selecione as melhores questões em nosso banco de atividades

Começar
Entendi! Quero começar!

Filtrar

Organize sua prova

Arraste suas questões e solte-as aqui.

Arraste
e solte aqui

Escolha suas questões abaixo

Biologia Questão 01 - FUVEST 2018 2ª fase - 3º Dia

As figuras I e II pirâmides ecológica de biomassa para dois ecossistemas 

a) Indique um ecossistema que cada uma dessas pirâmides de biomassa possa representar. 

b) Desenhe as pirâmides de energia correspondentes às pirâmides de biomassa, para os dois ecossistemas indicados. 

Matemática Questão 01 - FUVEST 2017 2ª fase - 3º dia

Considere uma folha de papel retangular com lados 20 cm e 16 cm. Após remover um quadrado de lado x cm de cada um dos cantos da folha, foram feitas 4 dobras para construir uma caixa (sem tampa) em forma de paralelepípedo reto-retângulo com altura x cm. As linhas tracejadas na figura indicam onde as dobras foram feitas.

a) Expresse o volume da caixa em função de x.

b) Determine o conjunto dos valores de x para os quais o volume da caixa é maior ou igual a 384 cm3.

Questão 01 - UEL 2017 2ª fase - 2º dia - Matemática

No plano cartesiano ao lado, cada um dos pontos representa a massa (m) de um medicamento existente no sangue de um animal no instante (t) em que foi feita cada medição depois do instante inicial, t = 0, da aplicação.

Considerando todos os instantes entre as medições apresentadas no plano cartesiano, responda aos itens a seguir.

a) Sabendo que a relação que descreve a massa (m) do medicamento, após t horas da aplicação, é dada por  em que C e D são constantes, determine C e D na relação dada.

Justifique sua resposta apresentando os cálculos realizados na resolução deste item.​

b) Após quanto tempo da administração, a massa desse medicamento será inferior a 60% da massa que foi medida depois de 2 horas da aplicação?

Justifique sua resposta apresentando os cálculos realizados na resolução deste item.

Questão 01 - UEL 2017 2ª fase - 2º dia - Física

No modelo padrão da física das partículas elementares, o próton e o nêutron são partículas compostas constituídas pelas combinações de partículas menores chamadas de quarks u (up) e d (down). Nesse modelo, o próton (p) e o nêutron (n) são compostos, cada um, de três quarks, porém com diferentes combinações, sendo representados por p = (u, u, d) e n = (u, d, d). Os prótons e os nêutrons comportam-se, na presença de um campo magnético, como se fossem minúsculos ímãs, cujas intensidades são denominadas de momento magnético e medidas em magnetons nucleares (mn). Para o próton, o momento magnético é dado por

enquanto que, para o nêutron, o momento magnético é dado por

O momento magnético dos quarks u e d são dados por

em que 

A partir dessas informações, responda aos itens a seguir.

a) Determine o valor da razão entre o momento magnético dos quarks u e d.

b) Determine o valor adimensional da razão 

Questão 01 - UEL 2017 2ª fase - 2º dia - Biologia

A reintrodução de lobos no Parque Nacional de Yellowstone, nos EUA, tem sido um estudo de caso ecológico sobre a importância de predadores de topo de cadeia, como evidenciado no texto a seguir.

A partir do século XX, as pessoas conseguiram erradicar os lobos de Yellowstone. Na ausência dos predadores, alces e veados invadiram as terras selvagens remanescentes, desnudando árvores ribeirinhas e arbustos, acelerando a erosão e a degradação do habitat das aves e dos peixes adaptados ao antigo ambiente. Em 1995 e 1996, o Fish and Wildlife Service (órgão dos EUA dedicado a preservar a vida selvagem) capturou lobos no Canadá e lançou-os de volta nos 2,2 milhões de hectares do Parque Nacional de Yellowstone e nas áreas de deserto de Idaho. Com isso, os alces reaprenderam a ter cautela enquanto percorriam o campo aberto. Essa “paisagem do medo” mudou seu comportamento. Em cantos do parque, frequentados por lobos e álamos, salgueiros começaram a se recuperar. Com a volta das árvores, vieram castores, pássaros, rãs e peixes. O parque ainda enfrenta muitas dificuldades, mas o retorno dos predadores de topo tem, sem dúvida, ajudado a melhorar seu ecossistema.

(Adaptado de: Como os lobos podem ajudar a salvar um ecossistema. Disponível em: . Acesso em: 19 ago. 2016.)

Com base nesse texto, esquematize uma cadeia alimentar que envolva o lobo, o alce e o salgueiro, apontando a qual nível trófico cada um desses organismos pertence. Cite e explique as relações ecológicas interespecíficas nessa cadeia alimentar.

Questão 01 - FAMERP 2017 1º dia - Conhecimentos Gerais

Um copo inicialmente vazio foi enchido com água por meio de uma torneira com vazão constante. O gráfico mostra a altura da água no copo em função do tempo durante seu enchimento até a boca.

De acordo com o gráfico, um formato possível do copo é



( a )

( b )

( c )

( d )

( e )

Questão 01 - UNIFESP 2017 2º dia

Na costa oeste da América do Norte, as comunidades marinhas que ocupam a zona rochosa entremarés são biologicamente diversas. Nessa zona, ocorrem mexilhões da espécie Mytilus californianus, que é dominante e concorre fortemente por espaço com as demais espécies presentes. A estrela-do-mar Pisaster ochraceus é o principal predador de Mytilus californianus, além de outros organismos, como ilustra a teia alimentar em que a espessura das setas é proporcional à frequência de alimentação.

Robert Paine, pesquisador da Universidade de Washington, realizou um experimento no qual examinou o efeito da remoção de Pisaster ochraceus sobre o número das demais espécies presentes nessa zona ao longo de dez anos. Os resultados são apresentados no gráfico.

a) Em qual nível trófico da teia alimentar a energia química disponível é menor? Justifique sua resposta.

b) Por que a retirada de Pisaster ochraceus interferiu no número de espécies presentes na zona entremarés em que o experimento foi realizado?

Questão 01 - FUVEST 2017 2ª fase - 2º dia

Baseando-se na tirinha cômica “Mama Taxi”, responda, em português, ao que se pede.

a) A que se refere a pergunta feita no segundo quadro pela motorista à passageira? Justifique sua resposta

b) Qual foi a resposta dada pela passageira à pergunta feita pela motorista no segundo quadro? Qual foi a ação assumida pela passageira na sequência de sua resposta?

Questão 01 - UNIFESP 2018 1º Dia - Prova de Língua Portuguesa; Língua Inglesa e Redação

Do fundo de Pernambuco, o pai mandou-lhe um telegrama:

“Não saia casa 3 outubro abraços”.

O rapaz releu, sob emoção grave. Ainda bem que o velho avisara: em cima da hora, mas avisara. Olhou a data: 28 de setembro. Puxa vida, telegrama com a nota de urgente, levar cinco dias de Garanhuns a Belo Horizonte! Só mesmo com uma revolução esse telégrafo endireita. E passado às sete da manhã, veja só; o pai nem tomara o mingau com broa, precipitara-se na agência para expedir a mensagem.

Não havia tempo a perder. Marcara encontros para o dia seguinte, e precisava cancelar tudo, sem alarde, como se deve agir em tais ocasiões. Pegou o telefone, pediu linha, mas a voz de d. Anita não respondeu. Havia tempo que morava naquele hotel e jamais deixara de ouvir o “pois não” melodioso de d. Anita, durante o dia. A voz grossa, que resmungara qualquer coisa, não era de empregado da casa; insistira: “como é?”, e a ligação foi dificultosa, havia besouros na linha. Falou rapidamente a diversas pessoas, aludiu a uma ponte que talvez resistisse ainda uns dias, teve oportunidade de escandir as sílabas de arma virumque cano1 , disse que achava pouco cem mil unidades, em tal emergência, e arrematou: “Dia 4 nós conversamos.” Vestiu-se, desceu. Na portaria, um sujeito de panamá bege, chapéu de aba larga e sapato de duas cores levantou-se e seguiu-o. Tomou um carro, o outro fez o mesmo. Desceu na praça da Liberdade e pôs-se a contemplar um ponto qualquer. Tirou do bolso um caderninho e anotou qualquer coisa. Aí, já havia dois sujeitos de panamá, aba larga e sapato bicolor, confabulando a pequena distância. Foi saindo de mansinho, mas os dois lhe seguiram na cola. Estava calmo, com o telegrama do pai dobrado na carteira, placidez satisfeita na alma. O pai avisara a tempo, tudo correria bem. Ia tomar a calçada quando a baioneta em riste advertiu: “Passe de largo”; a Delegacia Fiscal estava cercada de praças, havia armas cruzadas nos cantos. Nos Correios, a mesma coisa, também na Telefônica. Bondes passavam escoltados. Caminhões conduziam tropa, jipes chispavam. As manchetes dos jornais eram sombrias; pouca gente na rua. Céu escuro, abafado, chuva próxima.

Pensando bem, o melhor era recolher-se ao hotel; não havia nada a fazer. Trancou-se no quarto, procurou ler, de vez em quando o telefone chamava: “Desculpe, é engano”, ou ficava mudo, sem desligar. Dizendo-se incomodado, jantou no quarto, e estranhou a camareira, que olhava para os móveis como se fossem bichos. Deliberou deitar-se, embora a noite apenas começasse. Releu o telegrama, apagou a luz.

Acordou assustado, com golpes na porta. Cinco da manhã. Alguém o convidava a ir à Delegacia de Ordem Política e Social. “Deve ser engano.” “Não é não, o chefe está à espera.” “Tão cedinho? Precisa ser hoje mesmo? Amanhã eu vou.” “É hoje e é já.” “Impossível.” Pegaram-lhe dos braços e levaram-no sem polêmica. A cidade era uma praça de guerra, toda a polícia a postos. “O senhor vai dizer a verdade bonitinho e logo” – disse-lhe o chefe. – “Que sabe a respeito do troço?” “Não se faça de bobo, o troço que vai estourar hoje.” “Vai estourar?” “Não sabia? E aquela ponte que o senhor ia dinamitar mas era difícil?” “Doutor, eu falei a meu dentista, é um trabalho de prótese que anda abalado. Quer ver? Eu tiro.” “Não, mas e aquela frase em código muito vagabundo, com palavras que todo mundo manja logo, como arma e cano?” “Sou professor de latim, e corrigi a epígrafe de um trabalho.” “Latim, hem? E a conversa sobre os cem mil homens que davam para vencer?” “São unidades de penicilina que um colega tomou para uma infecção no ouvido.” “E os cálculos que o senhor fazia diante do palácio?” Emudeceu. “Diga, vamos!” “Desculpe, eram uns versinhos, estão aqui no bolso.” “O senhor é esperto, mas saia desta. Vê este telegrama? É cópia do que o senhor recebeu de Pernambuco. Ainda tem coragem de negar que está alheio ao golpe?” “Ah, então é por isso que o telegrama custou tanto a chegar?” “Mais custou ao país, gritou o chefe. Sabe que por causa dele as Forças Armadas ficaram de prontidão, e que isso custa cinco mil contos? Diga depressa.” “Mas, doutor…” Foi levado para outra sala, onde ficou horas. O que aconteceu, Deus sabe. Afinal, exausto, confessou: “O senhor entende conversa de pai pra filho? Papai costuma ter sonhos premonitórios, e toda a família acredita neles. Sonhou que me aconteceria uma coisa no dia 3, se eu saísse de casa, e telegrafou prevenindo. Juro!”

Dia 4, sem golpe nenhum, foi mandado em paz. O sonho se confirmara: realmente, não devia ter saído de casa.

(70 historinhas, 2016.)

1arma virumque cano: “canto as armas e o varão” (palavras iniciais da epopeia Eneida, do escritor Vergílio, referentes ao herói Eneias).

De acordo com a crônica, o filho recebeu o telegrama do pai no dia 



( a )

4 de outubro. 

( b )

29 de setembro. 

( c )

2 de outubro. 

( d )

28 de setembro. 

( e )

3 de outubro.​

Questão 01 - FUVEST 2018 2ª fase - 2º Dia

Levando em consideração que o texto busca caracterizar dois tipos de personagens encontradas nas obras de ficção, responda em português:

a) Como o texto caracteriza a personagem estática?

b) O que torna atraente a personagem dinâmica?

Questão 01 - UNICAMP 2018 2ª Fase - 3º dia

Dados genéticos podem ser utilizados para estudar populações de uma espécie no ambiente natural. Por exemplo, amostras de DNA podem ser coletadas para identificar espécies, estimar tamanhos populacionais ou identificar indivíduos. Um pesquisador coletou duas amostras de fezes em uma localidade na índia e sequenciou parte do gene Gapdh dos DNAs extraídos a partir delas. Como resultado, foram obtidas as sequências abaixo (apenas uma das fitas do DNA é mostrada). 

Amostra 1                         5' ACAGGATCCAATAACCCCGCAGGAATGGTG 3' Amostra 2                         5' ACAGGATCCAATAACCCCTCACGAATGGTG 3' 

As sequências da mesma região do gene Gapdh nos genomas do tigre de Bengala (Panthera tigris) e do leopardo (Panthera pardus) são:

Panthera tigris                                            5' ACAGGATCCAATAACCCCGCAGGAATGGTG 3' Panthera pardus                                        5' ACAGGATCTAACAACCCCGCAGGAATAGTA 3' 

a) De posse desses dados, responda: as amostras de fezes 1 e 2 pertencem, com maior probabilidade, a tigres de Bengala ou a leopardos? As amostras 1 e 2 pertencem ao mesmo indivíduo ou a dois indivíduos diferentes? Justifique sua resposta.

b) Um crítico argumentou que o trabalho do pesquisador não era válido, pois as sequências do gene nuclear Gapdh foram obtidas a partir de amostras de fezes. Segundo o critico, material genético nuclear de felinos só poderia ser extraído com qualidade a partir de hemácias (eritrócitos) coletadas dos animais. Quem tem razão, o pesquisador ou o crítico? Justifique. 

(Fonte: J. Bhagavatula e L. Singh. BMC Genetics. Londres, v. 7, p. 48. out. 2006.) 

Questão 01 - UNICAMP 2019 1ª Fase - Prova Q e X

“Acho que só devemos ler a espécie de livros que nos ferem e trespassam. Um livro tem que ser como um machado para quebrar o mar de gelo do bom senso e do senso comum."

(Adaptado de “Franz Kafka, carta a Oscar Pollak, 1904.” Disponível em https://laboratoriode sensibilidades.wordpress.com. Acessado em 28/05/2018.)

Assinale o excerto que confirma os dois textos anteriores.

Excertos adaptados de: Marisa Lajolo, A formação do leitor no Brasil. São Paulo: Ática, 1996, p. 28. Antonio Candido, Vários escritos. São Paulo: Duas cidades, 2004, p.187. Gilberto Gil, Discurso no lançamento do Ano Ibero-Americano da Leitura, 2004. Fernando Pessoa, Páginas íntimas e de Auto-Interpretação. São Paulo: Ática, 1966, p. 23.



( a )

A leitura é, fundamentalmente, processo político. Aqueles que formam leitores – professores, bibliotecários – desempenham um papel político. (Marisa Lajolo) 

( b )

Pelo que sabemos, quando há um esforço real de igualitarização, há aumento sensível do hábito de leitura, e portanto difusão crescente das obras. (Antonio Candido) 

( c )

Ler é abrir janelas, construir pontes que ligam o que somos com o que tantos outros imaginaram, pensaram, escreveram; ler é fazer-nos expandidos. (Gilberto Gil) 

( d )

A leitura é uma forma servil de sonhar. Se tenho de sonhar, por que não sonhar os meus próprios sonhos? (Fernando Pessoa).

Questão 01 - FUVEST 2018 1ª fase - Prova V

Um fabricante de acessórios de montanhismo quer projetar um colchão de espuma apropriado para ser utilizado por alpinistas em regiões frias. Considere que a taxa de transferência de calor ao solo por uma pessoa dormindo confortavelmente seja 90 kcal/hora e que a transferência de calor entre a pessoa e o solo se dê exclusivamente pelo mecanismo de condução térmica através da espuma do colchão. Nestas condições, o gráfico representa a taxa de transferência de calor, em J/s, através da espuma do colchão, em função de sua espessura, em cm

Considerando 1 cal = 4J, a menor espessura do colchão, em cm, para que a pessoa durma confortavelmente



( a )

1,0. 

( b )

1,5. 

( c )

2,2

( d )

2,8

( e )

3,9

Questão 01 - UNICAMP 2018 2ª Fase - 1º dia

Enquanto viveu em Portugal, o escritor Mário Prata reuniu centenas de vocábulos e expressões usados no português falado na Europa que são diferentes dos termos correspondentes usados no português do Brasil. Reproduzimos abaixo um dos verbetes de seu dicionário.

Descapotável

É outra palavra que em português faz muito mais sentido do que em brasileiro. Não é mais claro dizer que um carro é descapotável, do que conversível?

(Mário Prata, Dicionário de português: schifaizfavoire. São Paulo: Editora Globo, 1993, p. 48.)

a) Identifique os dois afixos que formam a palavra “descapotável” a partir do substantivo “capota” (cobertura de um automóvel) e explique a função de cada um.

b) Explique por que o autor considera, com certo humor, que a palavra "descapotável” do português europeu faz mais sentido de que o termo “conversível”, usado no português brasileiro.

Questão 01 - UNIFESP 2017 1º dia

Examine a tira do cartunista argentino Quino (1932- ).

As frases citadas pela personagem Mafalda no início de sua fala foram extraídas de 



( a )

um anúncio publicitário.

( b )

um livro sobre culinária. 

( c )

uma peça de teatro. 

( d )

uma cartilha escolar. 

( e )

um guia turístico.

Inglês Questão 01 - ENEM 2019 - 1º dia - Azul

5 Ways Pets Can Improve Your Health

A pet is certainly a great friend. After a difficult day, pet owners quite literally feel the love.

In fact, for nearly 25 years, research has shown that living with pets provides certain health benefits. Pets help lower blood pressure and lessen anxiety. They boost our immunity. They can even help you get dates.

Allergy Fighters: A growing number of studies have suggested that kids growing up in a home with “furred animals” will have less risk of allergies and asthma.

Date Magnets: Dogs are great for making love connections. Forget Internet matchmaking — a dog is a natural conversation starter.

Dogs for the Aged: Walking a dog or just caring for a pet — for elderly people who are able — can provide exercise and companionship.

Good for Mind and Soul: Like any enjoyable activity, playing with a dog can elevate levels of serotonin and dopamine — nerve transmitters that are known to have pleasurable and calming properties.

Good for the Heart: Heart attack patients who have pets survive longer than those without, according to several studies. 

DAVIS, J. L. Disponível em: www.webmd.com.   Acesso em: 21 abr. 2013 (adaptado). 

Ao discutir sobre a influência de animais de estimação no bem-estar do ser humano, a autora, a fim de fortalecer seus argumentos, utiliza palavras e expressões como research, a growing number of research e several studies com o objetivo de



( a )

mostrar que animais de estimação ajudam na cura de doenças como alergias e asma.

( b )

convencer sobre os benefícios da adoção de animais de estimação para a saúde.

( c )

fornecer dados sobre os impactos de animais de estimação nas relações amorosas.

( d )

explicar como o contato com animais de estimação pode prevenir ataques cardíacos.

( e )

esclarecer sobre o modo como idosos devem se relacionar com animais de estimação.

Questão - Proposta de redação - ENEM 2018 1° dia - Caderno 2 - Amarelo

INSTRUÇÕES PARA A REDAÇÃO

1. O rascunho da redação deve ser feito no espaço apropriado. 2. O texto definitivo deve ser escrito à tinta, na folha própria, em até 30 linhas. 3. A redação que apresentar cópia dos textos da Proposta de Redação ou do Caderno de Questões terá o número de linhas copiadas desconsiderado para efeito de correção. 4. Receberá nota zero, em qualquer das situações expressas a seguir, a redação que:

4.1. tiver até 7 (sete) linhas escritas, sendo considerada "texto insuficiente". 4.2. fugir ao tema ou que não atender ao tipo dissertativo-argumentativo. 4.3. apresentar parte do texto deliberadamente desconectada do tema proposto.

TEXTOS MOTIVADORES

TEXTO I

Às segundas-feiras pela manhã, os usuários de um serviço de música digital recebem uma lista personalizada de músicas que lhes permite descobrir novidades. Assim como os sistemas de outros aplicativos e redes sociais, este cérebro artificial consegue traçar um retrato automatizado do gosto de seus assinantes e constrói uma máquina de sugestões que não costuma falhar. O sistema se baseia em um algoritmo cuja evolução e usos aplicados ao consumo cultural são infinitos. De fato, plataformas de transmissão de vídeo on-line começam a desenhar suas séries de sucesso rastreando o banco de dados gerado por todos os movimentos dos usuários para analisar o que os satisfaz. O algoritmo constrói assim um universo cultural adequado e complacente com o gosto do consumidor, que pode avançar até chegar sempre a lugares reconhecíveis. Dessa forma, a filtragem de informação feita pelas redes sociais ou pelos sistemas de busca pode moldar nossa maneira de pensar. E esse é o problema principal: a ilusão de liberdade de escolha que muitas vezes é gerada pelos algoritmos.

VERDCI. Daniel. O gosto na era do algoritmo. Osponivel em. Mtps.libiasitelpals.corn. Acesso em. 11 Jun. 2018 (adaptado).

TEXTO II

Nos sistemas dos gigantes da intemet, a filtragem de dados é transferida para um exército de moderadores em empresas localizadas do Oriente Médio ao Sul da Ásia, que têm um papel importante no controle daquilo que deve ser eliminado da rede social, a partir de sinalizações dos usuários. Mas a informação é então processada por um algoritmo, que tem a decisão final. Os algoritmos são literais. Em poucas palavras, são uma opinião embrulhada em código. E estamos caminhando para um estágio em que é a máquina que decide qual notícia deve ou não ser lida.

PEPE ESCOBAR. A silenciosa ditadura do algoritmo. Disponível em' Ntoficutraspalavrasnet. Acesso em: 5 Jun. 2017 (adaptado).

TEXTO III

TEXTO IV

Mudanças sutis nas informações às quais somos expostos podem transformar nosso comportamento. As redes têm selecionado as notícias sob títulos chamativos como "trending topics" ou critérios como "relevância". Mas nós praticamente não sabemos como isso tudo é filtrado. Quanto mais informações relevantes tivermos nas pontas dos dedos, melhor equipados estamos para tomar decisões. No entanto, surgem algumas tensões fundamentais: entre a conveniência e a deliberação; entre o que o usuário deseja e o que é melhor para ele; entre a transparência e o lado comercial. Quanto mais os sistemas souberem sobre você em comparação ao que você sabe sobre eles, há mais riscos de suas escolhas se tornarem apenas uma série de reações a "cutucadas" invisíveis. O que está em jogo não é tanto a questão "homem versus máquina", mas sim a disputa "decisão informada versus obediência influenciada".

CHATFIELD. Tom. Como a Internet Influencia secretamente nossas escolhas. Disponível em: wwwbbc.com. Acesso em: 3 Jun. 2017 (adaptado).

PROPOSTA DE REDAÇÃO

A partir da leitura dos textos motivadores e com base nos conhecimentos construídos ao longo de sua formação, redija um texto dissertativo-argumentativo em modalidade escrita formal da língua portuguesa sobre o tema "Manipulação do comportamento do usuário pelo controle de dados na internet", apresentando proposta de intervenção que respeite os direitos humanos. Selecione, organize e relacione, de forma coerente e coesa, argumentos e fatos para defesa de seu ponto de vista.

Questão 01 - UEL 2017 2ª fase - 2º dia - Geografia

(Disponível em:. Acesso em: 30 jul. 2016.)

Com base no mapa acima e nos conhecimentos sobre a bacia hidrográfica do Rio São Francisco, ou do “Velho Chico”, como é conhecido, responda aos itens a seguir.

a) Descreva duas características físicas que conferem importância econômica e social a esse contexto geográfico.

b) Cite uma das problemáticas ambientais e analise suas implicações para os diferentes usuários do “Velho Chico”. 

Questão 01 - UEL 2017 2ª fase - 2º dia - Filosofia

Leia o texto a seguir.

Seduzido por uma tal prova de força da razão, o impulso de ir mais além não vê limites. A leve pomba, ao sulcar livremente o ar, cuja resistência sente, poderia crer que, no vácuo, melhor ainda conseguiria desferir seu voo. Foi precisamente assim que Platão, abandonando o mundo dos sentidos que encerra o entendimento em limites tão estreitos, lançou-se nas asas das ideias pelo espaço vazio do entendimento puro. Não reparou que os seus esforços não logravam abrir caminho, porque não tinha um ponto de apoio, como que um suporte, em que se pudesse firmar as suas forças para mover o entendimento. É, porém, o destino corrente da razão humana, na especulação, concluir o seu edifício tão cedo quanto possível e só depois examinar se ele possui bons fundamentos.

(Adaptado de: KANT, I. Crítica da Razão Pura. 3.ed. Trad. Manuela Pinto dos Santos e Alexandre Fradique Morujão. Lisboa: Fundação Calouste Gulbenkian, 1994. p.41-42.)

Com base no texto e na epistemologia de Kant, disserte acerca de sua crítica ao conhecimento humano.

Questão 01 - FAMEMA 2017 Prova 2 - Objetiva e Redação

Leia o poema de Manuel Bandeira para responder a questão.

A estrada

Esta estrada onde moro, entre duas voltas do caminho, Interessa mais que uma avenida urbana. Nas cidades todas as pessoas se parecem. Todo o mundo é igual. Todo o mundo é toda a gente. Aqui, não: sente-se bem que cada um traz a sua alma. Cada criatura é única. Até os cães. Estes cães da roça parecem homens de negócios: Andam sempre preocupados. E quanta gente vem e vai! E tudo tem aquele caráter impressivo que faz meditar: Enterro a pé ou a carrocinha de leite puxada por um bodezinho manhoso. Nem falta o murmúrio da água, para sugerir, pela voz dos símbolos, Que a vida passa! que a vida passa! E que a mocidade vai acabar.

(Estrela da vida inteira, 2009.)

O poema faz referência



( a )

à pobreza do campo, quando comparada à riqueza das cidades. 

( b )

à possibilidade de as cidades se expandirem em direção ao campo.

( c )

à beleza que surge do crescimento e da modernização dos ambientes urbanos. 

( d )

à importância do jovem na construção de uma sociedade melhor. 

( e )

à desumanização dos indivíduos no processo de homogeneização das cidades.​

Questão 01 - FAMERP 2017 2º dia - Conhecimentos específicos e Redação

Os itens a seguir mostram, de forma resumida, as sequências do processo de eutrofização que leva ao desequilíbrio ecológico em um ambiente aquático.

1. Despejo de esgoto doméstico na água → ação dos decompositores → formação de nitratos e fosfatos;

2. Aumento da população de algas → turvação da superfície → morte das algas de fundo;

3. Aumento da população de micro-organismos X → morte de peixes e outros animais;

4. Aumento da população de micro-organismos Y → produção de gases (metano, sulfetos e mercaptanas).

a) As letras X e Y referem-se ao tipo de metabolismo energético realizado pelas respectivas populações de micro-organismos. Associe corretamente tais metabolismos às letras indicadas.

b) Explique por que as algas de fundo e os peixes morrem no processo de eutrofização.

Questão 01 - FUVEST 2017 2ª fase - 1º dia

Considere a imagem abaixo, extraída da apresentação do filme A Amazônia, que faz parte da campanha “A natureza está falando”.

No áudio desse filme, a atriz Camila Pitanga interpreta o seguinte texto:

Eu sou a Amazônia, a maior floresta tropical do mundo. Eu mando chuva quando vocês precisam. Eu mantenho seu clima estável. Em minhas florestas, existem plantas que curam suas doenças. Muitas delas vocês ainda nem descobriram. Mas vocês estão tirando tudo de mim. A cada segundo, vocês cortam uma das minhas árvores, enchem de sujeira os meus rios, colocam fogo, e eu não posso mais proteger as pessoas que vivem aqui. Quanto mais vocês tiram, menos eu tenho para oferecer. Menos água, menos curas, menos oxigênio. Se eu morrer, vocês também morrem, mas eu crescerei de novo...

a) Por estar em primeira pessoa, o texto constitui exemplo de uma determinada figura de linguagem. Identifique essa figura e explique seu uso, tendo em vista o efeito que o filme visa alcançar.

b) No referido áudio, é possível perceber, no final da locução da atriz, uma entonação especial, representada na transcrição por meio de reticências. Tendo em vista que uma das funções desse sinal de pontuação é sugerir uma ideia não expressa que cabe ao leitor inferir, identifique a ideia sugerida, neste caso.

Questão 01 - ENEM 2016 1° dia - Caderno 3 - Branco - 2ª Aplicação

Fundamos, como afirmam alguns cientistas, o antropoceno: uma nova era geológica com altíssimo poder de destruição, fruto dos últimos séculos que significaram um transtorno perverso do equilíbrio do sistema-Terra. Como enfrentar esta nova situação nunca ocorrida antes de forma globalizada e profunda? Temos pessoalmente trabalhado os paradigmas da sustentabilidade e do cuidado como relação amigável e cooperativa para com a natureza. Queremos, agora, agregar a ética da responsabilidade. 

BOFF. L. Responsabilidade coletiva. Disponível em: hltp://leonardoboRwordpress.com. Acesso em: 14 maio 2013. 

A ética da responsabilidade protagonizada pelo filósofo alemão Hans Jonas e reinvindicada no texto é expressa pela máxima: 



( a )

"A tua ação possa valer como norma para todos os homens."

( b )

"A norma aceita por todos advenha da ação comunicativa e do discurso."

( c )

"A tua ação possa produzir a máxima felicidade para a maioria das pessoas." 

( d )

"O teu agir almeje alcançar determinados fins que possam justificar os meios." 

( e )

"O efeito de tuas ações não destrua a possibilidade futura da vida das novas gerações."

Questão 01 - UNESP 2018 2ª Fase - Dia 1

Empunhando Durendal, a cortante, O rei tirou-a da bainha, enxugou-lhe a lâmina Depois cingiu-a em seu sobrinho Rolando E então o papa a benzeu. O rei disse-lhe docemente, rindo: “Cinjo-te com ela, desejando Que Deus te dê coragem e ousadia, Força, vigor e grande bravura E grande vitória sobre os infiéis.” E Rolando diz, o coração em júbilo: “Deus mo conceda, pelo seu digno comando.”

(La Chanson d’Aspremont, século XII. Apud Georges Duby. A Europa na Idade Média, 1988.)

a) Qual é a cerimônia medieval descrita no texto? Identifique dois versos do texto que contenham elementos religiosos.

b) Qual é a relação entre o rei e Rolando, personagens do poema? O que essa relação representa no contexto do feudalismo?

Questão 01 - UNICAMP 2018 2ª Fase - 2º dia

A ideia de que a demanda de especiarias resultava da necessidade de disfarçar o gosto da carne e do peixe putrefatos é um dos grandes mitos da história da alimentação. Na Europa medieval, os alimentos frescos eram mais frescos que os atuais, pois provinham da produção local. Os alimentos em conserva mantinham-se em salga, curtição, dessecação ou gordura, assim como hoje em dia são enlatados, refrigerados, liofilizados ou embalados a vácuo. De qualquer forma, os aspectos determinantes do papel desempenhado pelas especiarias na gastronomia eram o gosto e a cultura. A cozinha muito temperada com especiarias era objeto de desejo por ser cara e por "condimentar a posição social dos ricos e as aspirações de quem ambicionava sê-lo. Além disso, a moda gastronômica predominante na baixa Idade Média europeia imitava as receitas árabes, que exigiam sabores doces e ingredientes fragrantes: leite de amêndoa, extratos de flores aromáticas e outras iguarias orientais. 

(Adaptado de Felipe Armesto-Femández, 1492: o ano em que o mundo começou. São Paulo: Companhia das Letras. 2017, p.27). 

A partir do texto acima e de seus conhecimentos históricos:

a) defina o que são as especiarias e explique seu significado social na Europa medieval.

b) explique como era feito o comércio de especiarias na baixa Idade Média. 

Questão 01 - UNICAMP 2018 1ª Fase - Prova Q e X

Estrangeirismos são palavras e expressões de outras línguas usadas correntemente em nosso cotidiano. Sobre o emprego de palavras estrangeiras no português, o linguista Sírio Possenti comenta:

Tomamos alguns verbos do inglês e os adaptamos a nosso sistema verbal exclusivamente segundo regras do português. Se adotarmos start, logo teremos estartar (e todas as suas flexões), pois nossa língua não tem sílabas iniciais como st-, que imediatamente se tornam est-. A forma nunca será startar, nem ostartar ou ustartar, nem estarter ou estartir, nem printer ou printir, nem atacher ou atachir etc., etc., etc.

(Adaptado de Sírio Possenti, “A questão dos estrangeirismos”, em Carlos Alberto Faraco, Estrangeirismos: guerras em torno da língua. São Paulo: Parábola, 2001, p. 173-174.)

As alternativas abaixo reproduzem trechos de um fórum de discussão na Internet sobre um jogo eletrônico. Nessa discussão, um jogador queixa-se por não ter conseguido se conectar a uma partida e ter perdido pontos. Escolha a alternativa que contém um exemplo do processo de adaptação de verbos do inglês para o sistema verbal do português, como descreve Sírio Possenti.

(Adaptado de http://forums.br.leagueoflegends.com/board/showthread.php?t=187120. Acessado em 15/07/2017.)

Glossário:

Bug: falha devido ao mau funcionamento em um programa de informática. Computar: contar, incluir. Dar load: carregar. Lolking: site da Internet sobre o jogo Ranked: partida que dá pontos ao jogador Server: servidor; em informática, é um programa ou um computador que fornece serviços a uma rede de computadores. Upar: subir de nível, recarregar.



( a )

“Aconteceu logo na manhã deste domingo, quando iniciei uma ranked.” 

( b )

“Ela não deu load e pensei que era um bug no site.” 

( c )

“Entrei no lolking para ver se a partida estava sendo computada.” 

( d )

“Nem upei meu personagem de tanto problema no server.”

Questão 01 - FCMSCSP 2020 - 1º dia

Duas mulheres suecas estão carregando o útero de suas mães. Segundo os médicos responsáveis, esses são os primeiros transplantes de útero de mãe para filha. As cirurgias não tiveram complicações, mas os médicos só vão considerar o procedimento bem-sucedido se as mulheres conseguirem engravidar. Hormônios foram usados para estimular os ovários, que elas já tinham, para “amadurecer” os óvulos. Os cientistas vão fertilizar os óvulos com espermatozoides no laboratório e congelar os embriões que, depois de um tempo, serão transferidos para os úteros das pacientes se elas estiverem em boas condições de saúde.

(“Suecas recebem útero de suas próprias mães”. Folha de S.Paulo, 19.09.2012. Adaptado.)

a) Uma mulher menstrua desde que não tenha problemas hormonais ou no útero. Qual tecido uterino é eliminado durante a menstruação? O que acontece com a musculatura uterina quando ocorrem as cólicas?

b) Cite o hormônio que estimula os ovários a “amadurecer” os óvulos. Por que o transplante de órgãos, neste caso, o útero, entre mãe e filha, muitas vezes apresenta maior viabilidade que o transplante entre mulheres não aparentadas?

 

Questão 01 - UNIFESP 2018 2º Dia - Prova de Conhecimentos Específicos

No início de 2017, o Brasil registrou uma das maiores epidemias de febre amarela de sua história. Em uma aula de Biologia, a professora dividiu a classe em dois grupos, solicitando que discutissem previamente e apresentassem seus conhecimentos sobre a doença. Os grupos trouxeram as seguintes informações:

Grupo 1 – Trata-se de doença associada ao saneamento precário, à falta de banheiros e ao consumo de alimentos contaminados. Na zona urbana, a transmissão da febre amarela é feita pelo mesmo transmissor de outras doenças, o que potencializa a propagação de várias enfermidades.

Grupo 2 – A forma silvestre da febre amarela encontra-se associada a ambientes abertos e secos, e a expansão da fronteira agrícola contribui para que a doença se espalhe pelas áreas urbanas. A vacinação é a forma mais eficaz para combater a disseminação da doença.

a) Com relação às informações apresentadas pelo Grupo 1, identifique a informação que está correta, complementando-a com detalhamentos que confirmem sua veracidade.

b) Com relação às informações apresentadas pelo Grupo 2, identifique a informação que está errada, reescrevendo-a de modo correto.

Questão 01 - UNESP 2018 1ª Fase - Dia 1

Examine a tira Hagar, o Horrível do cartunista americano Dik Browne (1917-1989).

O ensinamento ministrado por Hagar a seu filho poderia ser expresso do seguinte modo:



( a )

"A fome é a companheira do homem ocioso." 

( b )

''O estômago que raramente está vazio despreza alimentos vulgares." 

( c )

"Nada é mais útil ao homem do que uma sábia desconfiança? 

( d )

''Muitos homens querem uma coisa, mas não suas consequências." 

( d )

''É impossível para um homem ser enganado por outra pessoa que não seja ele mesmo." 

Questão 01 - UNESP 2017 2ª fase - 1º dia

Leia o trecho de A divina comédia, escrita pelo poeta italiano Dante Alighieri (1265-1321), no início do século XIV.

Como, em seu Arsenal1, os venezianos fervem, no inverno, o pegajoso pez2, pra de seus lenhos3  consertar os danos,

pois, não podendo navegar, ao invés há quem renove o lenho, ou calafete4 o casco que viagem muita fez;

e um na proa, na popa outro arremete, um faz o remo, outro torce o cordame, um remenda a grã vela, outro o traquete5.

(A divina comédia, 2009.)

1 arsenal: lugar de conserto de navios. 2 pez: piche. 3 lenho: barco. 4 calafetar: vedar, fechar. 5 traquete: mastro.

Nos versos, o poeta refere-se ao trabalho de reparação dos navios venezianos. Descreva a natureza do trabalho desenvolvido no arsenal e explique o motivo da crise econômica das cidades italianas a partir do final do século XV.

Estes materiais são parte integrante das coleções da editora Saraiva. Eles poderão ser reproduzidos desde que o título das obras e suas respectivas autorias sejam sempre citadas